View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5933_high_32 (Length: 217)
Name: NF5933_high_32
Description: NF5933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5933_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 29727697 - 29727881
Alignment:
| Q |
11 |
cgaagaatataaaatacataaataatatttgtacagtccatattctctgtcacttaagaaagattggtnnnnnnntttagatgatgcatattgtgcatat |
110 |
Q |
| |
|
||||||| ||||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29727697 |
cgaagaaaataaaatgcatcaataatatttgtacagtccatattctccgtcacttaagaaagattggtaaaaaaaattagatgatgcatattgtgcatat |
29727796 |
T |
 |
| Q |
111 |
tagacaaccttcaaaactcatttgggattgtctccgtgtcaggtgtatgtgtatgagaaatcatggcatctttgtgtagagttagaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29727797 |
tagacaaccttcaaaactcatttgggattgtctccgtgttagctg---gtgtatgagaaatcatggcatctttgtgtagagttagaac |
29727881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University