View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5933_low_25 (Length: 256)
Name: NF5933_low_25
Description: NF5933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5933_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 21 - 225
Target Start/End: Complemental strand, 26877264 - 26877060
Alignment:
| Q |
21 |
agcatatgtcattgccccatatacatgctctctcattggtttgcctgctatttcgtttaatttagtgcttcaaattccagaattattctcatcacacttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26877264 |
agcatatgtcattgccccatatacatgctctctcattggtttgcctgctatttcgtttaatttagtgcttcaaattccagaattattctcatcacacttg |
26877165 |
T |
|
| Q |
121 |
gacaataacgattagataagtagcatttcactttcatcttagaatcaaatttattaatcatgttccaaccaattgggacttcttttcaaacacgtttatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26877164 |
gacaataacgattagataagtagcatttcactttcatcttagaatcaaatttattaatcatgttccaaccaattgggacttcttttcaaacacgtttatg |
26877065 |
T |
|
| Q |
221 |
ctaag |
225 |
Q |
| |
|
||||| |
|
|
| T |
26877064 |
ctaag |
26877060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University