View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5933_low_33 (Length: 226)
Name: NF5933_low_33
Description: NF5933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5933_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 14382685 - 14382491
Alignment:
| Q |
18 |
aatacaaatgttgtaatgtgcaaatttatacccaaaacattaaccaagtgagtaaaaggaaaattaagcaaggtaaaagtaaaaccattactaatttact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14382685 |
aatacaaatgttgtaatgtgcaaatttatacccaaaacattaaccaagtgagtaaaaggaaaattaagcaaggtaaaagtaaaactattactaatttact |
14382586 |
T |
 |
| Q |
118 |
agaagagtgatattg-----aattgaagggaaaataatgaagcagcgtagtgcccttatgtcattgtcacattatacttcaatccatgcctgttc |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14382585 |
agaagagtgatattgaattaaattgaagggaaaataatgaagcagcgtagtgcccttatgtcattgtcacattatacttcaatccatgcctgttc |
14382491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University