View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5934-Insertion-11 (Length: 290)
Name: NF5934-Insertion-11
Description: NF5934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5934-Insertion-11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 94 - 191
Target Start/End: Complemental strand, 19689461 - 19689364
Alignment:
| Q |
94 |
gattaatcttcatttgaaataaagagttctagtcttattttattattttcttttgaaatcgcttgctaatgtatggnnnnnnnacgattcagaaactg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19689461 |
gattaatcttcatttgaaataaagagttctagtcttattttattattttcttttgaaatcgcttgctaatgtatggtttttttacgattcagaaactg |
19689364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 1308053 - 1307973
Alignment:
| Q |
7 |
caatcttagccttcatcaaagtctaatttttcttctctaaactctaaatctcttattttctcaattgggtttttg-aaaattttcatt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1308053 |
caatcttagccttcatcaaagtctaatttttcttctc-------taaatctcttattttctcaattgggtctttgaaaaattttcatt |
1307973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University