View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5934-Insertion-8 (Length: 437)
Name: NF5934-Insertion-8
Description: NF5934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5934-Insertion-8 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 6e-75; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 283 - 437
Target Start/End: Complemental strand, 16224848 - 16224694
Alignment:
| Q |
283 |
taagaatttaaaaacatgttgcaaatataaaattaatttatgttatgcaccggtatttatgactgtgactgcagtttaaacccttgatccttcttgctca |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16224848 |
taagattttaaaaacatgttgcaaatataaaattaattcatgttatgcaccggtatttatgactgtgactgcagtttaaacccttgatccttcttgctca |
16224749 |
T |
|
| Q |
383 |
atggcctcggcaccttctccctcattctctccacttaactcttccaacgattttc |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16224748 |
gtggcctcggcaccttctccctcattctctccacttaactcttccaacgattttc |
16224694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 370 - 437
Target Start/End: Complemental strand, 16185371 - 16185304
Alignment:
| Q |
370 |
tccttcttgctcaatggcctcggcaccttctccctcattctctccacttaactcttccaacgattttc |
437 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
16185371 |
tccttcttgttcagtggcctcggcaccttctccctcgttctctccactcaactcttccaacgattttc |
16185304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 335 - 437
Target Start/End: Original strand, 16173956 - 16174058
Alignment:
| Q |
335 |
gtatttatgactgtgactgcagtttaaacccttgatccttcttgctcaatggcctcggcaccttctccctcattctctccacttaactcttccaacgatt |
434 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||||||||||| | || |||| ||| |||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
16173956 |
gtattcatgactgtgagcacagtttaaacccccgatccttcttgccgagtgtcctcaacactttctccttcattctctccactcaactcttccaatgatt |
16174055 |
T |
|
| Q |
435 |
ttc |
437 |
Q |
| |
|
||| |
|
|
| T |
16174056 |
ttc |
16174058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University