View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5934_high_10 (Length: 249)
Name: NF5934_high_10
Description: NF5934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5934_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 46685042 - 46685162
Alignment:
| Q |
18 |
gttgttgctgtttgattttcaaatcaggagggaacnnnnnnnnnnnnngaggacgaagcagaagagatagagaagggcgcaggaaaagaagaagatggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46685042 |
gttgttgctgtttgattttcaaatcaggagggaacaaaaagaaaaaaagaggacgaaacagaagagatagagaagggcgcaggaaaagaagaagatggtg |
46685141 |
T |
|
| Q |
118 |
tgggcatgataaaaggatcta |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46685142 |
tgggcatgataaaaggatcta |
46685162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University