View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5934_high_5 (Length: 331)
Name: NF5934_high_5
Description: NF5934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5934_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 15 - 327
Target Start/End: Complemental strand, 5546325 - 5546013
Alignment:
| Q |
15 |
acattctccacaaacatacaccattattctcccattcttttttcttctatagaatcatatatacttgcaattatgagaattgatgtatccgttagtgtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5546325 |
acattctccacaaacatacaccattattctcccattcttttttcttctatagaatcatatatacttgcaattatgagagttgatgtatccgttagtgtga |
5546226 |
T |
 |
| Q |
115 |
ttgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546225 |
ttgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccga |
5546126 |
T |
 |
| Q |
215 |
catgcttggtgaccccatttgcagggtccgccactccccttcttacctcatgctggtatatattcacaaaaatcattcattttcactattctattacttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546125 |
catgcttggtgaccccatttgcagggtccgccactcaccttcttacctcatgctggtatatattcacaaaaatcattcattttcactattctattactta |
5546026 |
T |
 |
| Q |
315 |
cattcttctctct |
327 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5546025 |
cattcttctctct |
5546013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 134 - 244
Target Start/End: Original strand, 39917998 - 39918108
Alignment:
| Q |
134 |
taataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatt |
233 |
Q |
| |
|
||||||||| | |||||| || ||||||||||||| | ||||||||||||||| ||| | ||||| |||||||||||| ||| |||||||| ||| |
|
|
| T |
39917998 |
taataaagatagagaaagtgttgaagcagttgaaaaaatatgtgaagttggacccagtggtaagctttccctcttcaccgacttgcacggtgaccctatt |
39918097 |
T |
 |
| Q |
234 |
tgcagggtccg |
244 |
Q |
| |
|
||||| ||||| |
|
|
| T |
39918098 |
tgcagagtccg |
39918108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University