View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5936-Insertion-8 (Length: 242)
Name: NF5936-Insertion-8
Description: NF5936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5936-Insertion-8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 10 - 136
Target Start/End: Complemental strand, 2618877 - 2618750
Alignment:
| Q |
10 |
tttttgcaggaaccaca-agtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618877 |
tttttgcaggaaccacctagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
2618778 |
T |
|
| Q |
109 |
tctttttctcacaaccttcaatgtgcac |
136 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
2618777 |
tctttttctcacaaccttcaatctgcac |
2618750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 38 - 136
Target Start/End: Complemental strand, 2630557 - 2630459
Alignment:
| Q |
38 |
cccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaactctttttctcacaaccttcaatgtgcac |
136 |
Q |
| |
|
||||| |||||||| ||||||||| || |||||| |||||||||| |||| || | ||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
2630557 |
cccatgcttgcaaataaagtcacaattttggcttagaattgggccaacgcatggaccaacgaagtcaggactctttttctcacaaccttcaatttgcac |
2630459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University