View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5936_high_7 (Length: 268)
Name: NF5936_high_7
Description: NF5936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5936_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 78 - 251
Target Start/End: Complemental strand, 12383284 - 12383106
Alignment:
| Q |
78 |
gctaaatgacatttattttaaaatagatgaggcatttaataagca-----acaaaaaacaataggacacacaaaggacttcatggaaatcacaggcaacg |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12383284 |
gctaaatgacattcattttaaaatagatgaggcatttaataagcatggcaacaaaaaacaataggacacacaaaggacttcatggaaatcaaaggcaacg |
12383185 |
T |
 |
| Q |
173 |
gaattgcccaaattaatatgtagagtacgtgaaagatatattacccatcaacttaatttatgaattcttttgatgcatg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12383184 |
gaattgcccaaattaatatgtagagtacgtgaaagatatattatccatcaacttaatttatgaattcttttgatgcatg |
12383106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University