View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5936_high_9 (Length: 246)
Name: NF5936_high_9
Description: NF5936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5936_high_9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 30278679 - 30278918
Alignment:
| Q |
7 |
caaaggttggagttaagcgcggaggaggaccagggcagttctcccggataggggtcttgtacctgcaaaaacaccaatactcaaatcattttttggatca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
30278679 |
caaaggttggagttaagcgcggaggaggaccagggcagttctcccggataggggtcttgtacctgcaaaaacaccaatactcaaatcaatttttgaatca |
30278778 |
T |
|
| Q |
107 |
gatgggtgataggtttaacatattagttgcgtacatttttcctataacaaaggtccatttatatgtagatttcaaaaaagataatgaaaaacttgtttag |
206 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30278779 |
gataggtgataggtttaacatattagttgcgtacatttttcctataacaaaggtccatttatatgtagatttcaaaaaagataaggaaaaacttatttag |
30278878 |
T |
|
| Q |
207 |
gtcaatgagggattcatgttgagattgatggatcacccta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30278879 |
gtcaatgagggattcatgttgagattgatggatcacccta |
30278918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University