View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5936_low_4 (Length: 364)
Name: NF5936_low_4
Description: NF5936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5936_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 8 - 348
Target Start/End: Complemental strand, 8570010 - 8569670
Alignment:
| Q |
8 |
cgaagaaaataactaggtagacaagtgaaatgataatatttgtactcgttgctcaaaaatgtgctaaagctttcatggcaggattccgtcctctttggta |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8570010 |
cgaaaaaaataactaggtagacaagtgaaatgataatatttgtactcgttgctcaaaaatgtgctaaagctttcatggcaggattccgtcctctttggta |
8569911 |
T |
 |
| Q |
108 |
ggtttccatcctctttgctgagctctaagctcccacaaagcagtttctttcatctgattttcaagtgctgtttcggctctttccctagcttcctcacatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569910 |
ggtttccatcctctttgctgagctctaagctcccacaaagcagtttctttcatctgattttcaagtgctgtttcggctctttccctagcttcctcacatg |
8569811 |
T |
 |
| Q |
208 |
tttccatccctgaattgcatttatcggcctccttttgatactgtgatgctattttcttagactctaaaagtaatatgtcagcatgtctttgttttctctc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569810 |
tttccatccctgaattgcatttatcggcctccttttgatactgtgatgctattttcttagactctaaaagtaatatgtcagcatgtctttgttttctctc |
8569711 |
T |
 |
| Q |
308 |
agcttcagcttccttttgctttaactcttcatgcaaaagat |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569710 |
agcttcagcttccttttgctttaactcttcatgcaaaagat |
8569670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University