View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5938_low_10 (Length: 230)
Name: NF5938_low_10
Description: NF5938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5938_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 13140749 - 13140529
Alignment:
| Q |
8 |
gcaccaatggattgcaatgcattcagtaagctaagttctaactaaccaagaaactactaccgccttttcttctcaatgacggtttaaagttttttaaaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13140749 |
gcaccaatggattgcaatgcattcagtaagctaagttataactaaccaagaaactactaccgcctttccttctcaatgacggtttaaagttttttaaaca |
13140650 |
T |
 |
| Q |
108 |
tattaaagaaatcagtatttt---------------tctttttcctatgacacttttaattatatttatcccattttacatatttctctgactatattta |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140649 |
tattaaagaaatcagtatttttcttatgaatttttttctttttcctatgacacttttaattatatttatcccattttacatatttctctgactatattta |
13140550 |
T |
 |
| Q |
193 |
acagttttagatattattgac |
213 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13140549 |
acagttttagatattattgac |
13140529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University