View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5938_low_9 (Length: 232)
Name: NF5938_low_9
Description: NF5938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5938_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 13140219 - 13140005
Alignment:
| Q |
17 |
aaaattggttgtacaaatatcaatcctctttatnnnnnnngcttatgacacatccataagctgttttgaatctatttccacaggctcttcaatatagctt |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140219 |
aaaattggttgtacaaatatcactcctctttatgaaaacagcttatgacacatccataagctgttttgaatctatttccacaggctcttcaatatagctt |
13140120 |
T |
|
| Q |
117 |
-------------ataacttatgtcaaaactcaaaacagtttaac-nnnnnnnnngaatattttgttatggaaatagcttatgcataaacacttaactaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13140119 |
ataaaaacagcttataacttatgtcaaaactcaaaacagtttaacttttttttttgaatatttttttatggaaatagcttatgcattaacacttaactaa |
13140020 |
T |
|
| Q |
203 |
gctattcatccaaac |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13140019 |
gctattcatccaaac |
13140005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 197
Target Start/End: Complemental strand, 21952541 - 21952507
Alignment:
| Q |
163 |
ttttgttatggaaatagcttatgcataaacactta |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21952541 |
ttttgttatagaaatagcttatgcataaacactta |
21952507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 197
Target Start/End: Original strand, 42641737 - 42641771
Alignment:
| Q |
163 |
ttttgttatggaaatagcttatgcataaacactta |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
42641737 |
ttttgttatggaaatagcttatacataaacactta |
42641771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 200
Target Start/End: Original strand, 51044563 - 51044600
Alignment:
| Q |
163 |
ttttgttatggaaatagcttatgcataaacacttaact |
200 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
51044563 |
ttttgttatagaaatagcttatacataaacacttaact |
51044600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 197
Target Start/End: Original strand, 46223176 - 46223210
Alignment:
| Q |
163 |
ttttgttatggaaatagcttatgcataaacactta |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
46223176 |
ttttgttatggaaatagcttatacataaacactta |
46223210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University