View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939-Insertion-12 (Length: 261)
Name: NF5939-Insertion-12
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939-Insertion-12 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 81 - 261
Target Start/End: Complemental strand, 4247501 - 4247321
Alignment:
| Q |
81 |
atacaattaattaatccatttataatccattagaagttcattaaagttcaattggttaatcatccattaatataaattatttgatttattcattaatagt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247501 |
atacaattaattaatccatttataatccattagaagttcattaaagttcaattggttaatcatccattaatataaattatttgatttattcattaatagt |
4247402 |
T |
|
| Q |
181 |
tttttcactaatgaatattcaatccaccaaaagaaaatatcttgagaaatttgcaatccttccatacttgctcttgatatg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247401 |
tttttcactaatgaatattcaatccaccaaaagaaaatatgttgagaaatttgcaatccttccatacttgctcttgatatg |
4247321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 4247539 - 4247499
Alignment:
| Q |
9 |
ctataaactccactagattttgcaaatagattggtttgata |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247539 |
ctataaactccactagattttgcaaatagattggtttgata |
4247499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University