View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_high_23 (Length: 344)
Name: NF5939_high_23
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 1673675 - 1673350
Alignment:
| Q |
1 |
acagttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacattatttggaggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673675 |
acagttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacattatttggaggtc |
1673576 |
T |
|
| Q |
101 |
cggaccaagattgggccttgaatggaataatcgatagttgacgatcttttagccttcgtgtgatggtaataagtatcgtaggttgtcgttcctttaggac |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1673575 |
cggaccaagattgggctttgaatggaataatcgatagtcgacgatcttttaaccttcatgtgatggtaataagtatcgtgggttgtcgttcctttaggac |
1673476 |
T |
|
| Q |
201 |
atgtcgttgtgggagaatttgctcaaagaggatgttagtttagataaaggttttatcgaggagttcaccataaagacattgtggttagtggcggttttat |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1673475 |
atgttgttgtgggagaatttgctcaaagaggatgttagtttagataaaggttttatcgaggagttcaccataaagacattgtggttagtggtggttttat |
1673376 |
T |
|
| Q |
301 |
atgtagggaccttcaatggaggttga |
326 |
Q |
| |
|
||||||||| ||| |||||||||||| |
|
|
| T |
1673375 |
atgtagggatctttaatggaggttga |
1673350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 3 - 88
Target Start/End: Complemental strand, 53379070 - 53378985
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacat |
88 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |||| ||||| ||||| | ||||||||| ||||| |||||||| |
|
|
| T |
53379070 |
agttgcaagcttcttcttcatgcttggtatcttgatgatgtgactcttgtaggggattcaaaggaggtggataaagctctagacat |
53378985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 88
Target Start/End: Original strand, 6172573 - 6172658
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacat |
88 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||| |||| ||||| ||||| | || ||||||| ||||| || ||||| |
|
|
| T |
6172573 |
agttgcaagattcttcttcatgtttggtatcttgatgatgggactcttgtaggggattcaaagtaggtggctaaagctctggacat |
6172658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 6251916 - 6251966
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgta |
53 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||| |||| ||||| |
|
|
| T |
6251916 |
agttgcaagcttcttcttcatgtttggtatcttgatgatgggactcttgta |
6251966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 3 - 95
Target Start/End: Complemental strand, 24323043 - 24322951
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacattatttgg |
95 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |||| || ||| ||||| |||||||| ||| ||||| |||||||| |||||| |
|
|
| T |
24323043 |
agttgcaagcttcttcttcatgcttggtatcttgatgatgggactcttataagggattcagaggaggaggctaaagctctagacatcatttgg |
24322951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 72
Target Start/End: Original strand, 10949877 - 10949946
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtgg |
72 |
Q |
| |
|
||||||||| || ||||| ||||| |||||||||||| ||||| | ||||| ||||| ||||||||||| |
|
|
| T |
10949877 |
agttgcaagctttttcttcatgctaggtatcttgatgctgagaattttgtatgggattcagaggaggtgg |
10949946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 72
Target Start/End: Original strand, 10957882 - 10957951
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtgg |
72 |
Q |
| |
|
||||||||| || ||||| ||||| |||||||||||| ||||| | ||||| ||||| ||||||||||| |
|
|
| T |
10957882 |
agttgcaagctttttcttcatgctaggtatcttgatgctgagaattttgtatgggattcagaggaggtgg |
10957951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 88
Target Start/End: Original strand, 29336754 - 29336839
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaaggatttagaggaggtggccaaagcactagacat |
88 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||| || || ||||| |||| ||||||| ||| | |||||||| |
|
|
| T |
29336754 |
agttgcaagcttcttcttcatgcttggtatcttaatgatgagactcttataggggattcagagaaggtggctaaatctctagacat |
29336839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 9684111 - 9684204
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgtaaagg-atttagaggaggtggccaaagcactagacattatttgg |
95 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||||| ||| ||||| || ||| |||||||||||| ||||| |||||||| |||||| |
|
|
| T |
9684111 |
agttgcaaacttcttcttcatgcttggtaccttgatgatgggacacctgtaaggggattcagaggaggtggctaaagctctagacatcatttgg |
9684204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 6820842 - 6820892
Alignment:
| Q |
3 |
agttgcaagtttcttcttaatgcttggtatcttgatgatgagactattgta |
53 |
Q |
| |
|
||||||||| ||||| || ||||||||||||||||||||| |||| ||||| |
|
|
| T |
6820842 |
agttgcaagcttctttttcatgcttggtatcttgatgatgggactcttgta |
6820892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University