View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_high_26 (Length: 267)
Name: NF5939_high_26
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 22774182 - 22774442
Alignment:
| Q |
1 |
atcttaatgttactaggtgttctttgcaattgaatatacttaacttcaatttgtgatattttttgttaaaatctttatgacgtaatgatcttttgattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22774182 |
atcttaatgttactaggtgttctttgcaattgaatataattaacttcaatttgtgatattttttgttaaaatctttatgacgtaatgatcttttgattaa |
22774281 |
T |
|
| Q |
101 |
cttcaatttgttgatgaaatcttgtgatattttgaaaacagtggatgtgaagatcaaggatggtaggataacaactatacgacagatggatacaccggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22774282 |
cttcaatttgttgatgaaatcttgtgatattttgaaaacagtggatgtgaagatcaaggatggtaggataacaactatacgacagatggatacaccggtt |
22774381 |
T |
|
| Q |
201 |
tcagacgataatgctcgatttgatattaccatactcgctgttgctgcatcgtctcatatgc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22774382 |
tcagacgataatgctcgatttgatattaccatactcgctgttgctgcatcgtctcctatgc |
22774442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University