View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_high_8 (Length: 488)
Name: NF5939_high_8
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 140 - 346
Target Start/End: Complemental strand, 43143256 - 43143050
Alignment:
| Q |
140 |
gatgcagatattggcagtcagcaggtgagagagaaggagagaatccaatgatgacgccacttccttatattattttatttggtatgtcaactccttttgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143256 |
gatgcagatattggcagtcagcaggtgagagagaaggagagaatccaatgatgacgccacttccttatattattttatttggtatgtcaactccttttgt |
43143157 |
T |
 |
| Q |
240 |
aatcttaggcattgcttttgcaaatggttggattaaggtaccaattagatagatgaggtcacacatttcattgttatgtgttcattctcattagtaatac |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143156 |
aatcttaggcattgcttttgcaaatggttggattaaggtaccaattagatagatgaggtcacacatttcattgttatgtgttcattctcattagtaatac |
43143057 |
T |
 |
| Q |
340 |
ttttcaa |
346 |
Q |
| |
|
|| |||| |
|
|
| T |
43143056 |
ttctcaa |
43143050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 346 - 401
Target Start/End: Complemental strand, 43143024 - 43142969
Alignment:
| Q |
346 |
actttttcacatatatgtaacggtacaaacattatgtcagcaatattcaattccag |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43143024 |
actttttcacatatatgtaacggtacaaatattatgtcagcaatattcaattccag |
43142969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 43143404 - 43143336
Alignment:
| Q |
9 |
gagatgaagaaaccaagaaaggagnnnnnnngaaatttataaccagagaacaagaaccagaacagtatg |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43143404 |
gagatgaagaaaccaagaaaggagaaaaaaagaaatttataaccagagaacaagaaccagaacagtatg |
43143336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University