View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_low_24 (Length: 344)
Name: NF5939_low_24
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 10 - 344
Target Start/End: Original strand, 53675958 - 53676299
Alignment:
| Q |
10 |
agcaaaggtggtgggcatgtatatcattttatcttgtcttgttatataagccaaaaatgaacctcctttttacaaaattttgtgcctttattatttttag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675958 |
agcaaaggtggtgggcatgtatatcattttatcttgtcttgttatataagccaaaaatgaacctcctttttacaaaattttgtgcctttattatttttag |
53676057 |
T |
 |
| Q |
110 |
tttt---------acttccagttggtaggaaagcttgttggactatttgcaattcttgnnnnnnntagttacagtcatcactttatcatcaatgaaactt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
53676058 |
tttttttttttttacttccagttggtaggaaagcttgttggactatttgcaattcttgaaaaaaatagttacattcatcactttatcatcaatgaaactt |
53676157 |
T |
 |
| Q |
201 |
tgagaggacactaactgttttctctttttctgatggatgataaagtggaaaatatttctgtctctaactaccaaaccttgcaaggttgccacatagcctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
53676158 |
tgagaggacactaactgttttctctttttctgatggatgataaagtggaaaatatttctgtctctaa--atcaaaccttgcaaggttgccacatagcctt |
53676255 |
T |
 |
| Q |
301 |
cattatttttgacatacacaacagcattagaggttttattttgt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53676256 |
cattatttttgacatacacaacagcattagaggttttattttgt |
53676299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University