View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_low_25 (Length: 279)
Name: NF5939_low_25
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 265
Target Start/End: Original strand, 23513884 - 23514134
Alignment:
| Q |
15 |
aatatgagacttttatttcaattttttgatttagtttcataggaagaatatttatgaagtttctcacacattaatagaagaggctaaatttatgactagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23513884 |
aatatgagacttttatttcaattttttgatttagtttcataggaagaatatttatgaagtttctcacacattaatagaagaggctaaatttatgactagc |
23513983 |
T |
|
| Q |
115 |
ttaaaataaagatattattnnnnnnnnnttgtattgatattctaaattgataagtaatttgaaatgcataaatatattctaaacatgacatttttattga |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23513984 |
ttaaaataaagatattattaaaaaaaaattgtattgatattctaaattgataactaatttgaaatgcataaatatattctaaacatgacatttttattga |
23514083 |
T |
|
| Q |
215 |
gatggatggaattaactttttattaacacaactttatttaaggtgaaatgt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23514084 |
gatggatggaattaactttttattaacacaactttatttaaggtgaaatgt |
23514134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University