View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5939_low_32 (Length: 217)
Name: NF5939_low_32
Description: NF5939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5939_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 37804614 - 37804816
Alignment:
| Q |
1 |
tcggtttactaacggtattgaattaagttaatgatttgttgaccactttcacaacaacaaaagcaatgtttcgcagaacagtgctattattgaagatcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
37804614 |
tcggtttactaacggtattgaattaagttaatgatttgttgaccactttcacaacaacaaaagcaatgtttcacagaaaggtgctattattgaagatcgt |
37804713 |
T |
 |
| Q |
101 |
agatgtcttttgtctaatatgggtaaaagttgtcatgttgagttcatcaggagacaacttaaaaagtttcgagattcctactattatcttttgaaagtat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37804714 |
agacgtcttttgtctaatatgggtaaaagttgtcatgttgagttcatcaggagacaacttaaaaagtttcgagattcctactattatcttttgaaagtat |
37804813 |
T |
 |
| Q |
201 |
aat |
203 |
Q |
| |
|
||| |
|
|
| T |
37804814 |
aat |
37804816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University