View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5940-Insertion-7 (Length: 255)
Name: NF5940-Insertion-7
Description: NF5940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5940-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 255
Target Start/End: Complemental strand, 15021380 - 15021134
Alignment:
| Q |
9 |
attttgttctccctattgatctcttttcatgcaaaacactctcagtttcttcacttttatcatttagatcacataataatgatagtaacaacaagtcaac |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15021380 |
attttgttctccctattcatctcttttcatgcaaaacactctcagtttcttcacttttatcatttagattacataataatgatagtaacaacaagtcaac |
15021281 |
T |
|
| Q |
109 |
aatcaaatttggagagtgcccttttgagtatttgaaggattgtgatggaaaagtgttgataaaggttatgccagagttcattacaaggcttgttaattga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15021280 |
aatcaaatttggagagtgcccttttgagtatttgaaggattgtgatggaaaagtgttgataaaggttatgccagagttcattacaaggcttgttaatgga |
15021181 |
T |
|
| Q |
209 |
ggagatagatcagggaatgattgctgcattagtagtaaaagtagctt |
255 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15021180 |
ggagatagatcaggggatgattgttgcattagtagtaaaagtagctt |
15021134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University