View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5941-Insertion-3 (Length: 455)
Name: NF5941-Insertion-3
Description: NF5941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5941-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 9e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 9 - 176
Target Start/End: Original strand, 17310096 - 17310263
Alignment:
| Q |
9 |
atctggatggttgagacagtgtcagggaatgctcctgtgcattggttcgcacaggacttcgtgtgctccattgctgtgttctccctagtttttaggcttt |
108 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17310096 |
atctggacggttgagacggtgtcagggaatgctcctgtgcattggttcgcacaggacttcgtgtgctccatcgctgtgttctccctagtttttaggcttt |
17310195 |
T |
|
| Q |
109 |
gacttaaagagctttgctttgtgggcttccagaccgtctggaacaaataaagtatatgctggtccttc |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| |||||||||| |||||||||| |||||| |
|
|
| T |
17310196 |
gacttaacgagctttgctttgtgggcttctagaccgtctagaacaaataacgtatatgctgctccttc |
17310263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 234 - 369
Target Start/End: Original strand, 17310321 - 17310456
Alignment:
| Q |
234 |
cataaatattttgatattatcaaggcaatgataatatgttagcgtgatcaaggcaatgcctcaagataatnnnnnnnntgtcactatcatggtactttct |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
17310321 |
cataaatattttgatattatcaaggcaatgataatatgttagcgtgatcaaggcaatgcctcaagataataaaaaaaatgtcactatcatgatactttct |
17310420 |
T |
|
| Q |
334 |
ccgttgttaattataagcaaattttaactttttaag |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17310421 |
ccgttgttaattataagcaaattttaactttttaag |
17310456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 370 - 455
Target Start/End: Original strand, 17310763 - 17310848
Alignment:
| Q |
370 |
gtcgaagggagtatcacaatatttgtttataaaagtcttgtttatagtttaacattgttcaaggagcattgatagcccacgcctac |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17310763 |
gtcgaagggagtatcacaatatttgtttataaaagtcttgtttatattttaacattgttcaaggagcattgatagcccacgcctac |
17310848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 325 - 367
Target Start/End: Original strand, 12165278 - 12165320
Alignment:
| Q |
325 |
gtactttctccgttgttaattataagcaaattttaacttttta |
367 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12165278 |
gtactctctccgttgttaattataagcaaattttgacttttta |
12165320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 365
Target Start/End: Original strand, 1741882 - 1741915
Alignment:
| Q |
332 |
ctccgttgttaattataagcaaattttaactttt |
365 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
1741882 |
ctccgttgttaattataagcaaattttgactttt |
1741915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University