View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5941_low_7 (Length: 276)
Name: NF5941_low_7
Description: NF5941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5941_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 40467297 - 40467131
Alignment:
| Q |
1 |
aacaagatagggtttcacgagctcatcacatacagtacgttccaaagtgtgtgacaaaagtttcaagactagctatgggtggatcacgagtgcaataaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40467297 |
aacaagatagggtttcacgagctcatcacatacagtacgttccaaagtgtgtgacaaaagtttcaagactagctatgggtggatcacgagtgcaataaga |
40467198 |
T |
 |
| Q |
101 |
gaataagtttcaaaactattttttaaaagagcaaaatatactagaatataagtttcaatccaaattg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40467197 |
gaataagtttcaaaactattttttaaaagagcaaaatatactagaatataagtttcaatcctaattg |
40467131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 40467072 - 40467026
Alignment:
| Q |
207 |
gttattaacattttgccaaaacttgaaagtattgagtatataaatca |
253 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40467072 |
gttattaccattttgccaaaacttgaaagtattgagtatataaatca |
40467026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University