View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5943_high_3 (Length: 290)
Name: NF5943_high_3
Description: NF5943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5943_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 40139314 - 40139543
Alignment:
| Q |
17 |
agacataggggaagaagataatgattcataaagaagggagggaattccttttcatcgttgtttgttcttgaatattcttctacaaacaacaaatacatct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40139314 |
agacataggggaagaagataatgattcataaagaagggaggaaattccttttcatcgttgtttgttcttgaatattcttctacaaacaacaaatacatct |
40139413 |
T |
|
| Q |
117 |
atggacgcaaaggacgggttagaccaaattgtatgtaacctgaactcgaccataacattagttcgagccaatttgtaaatcgatcccaaccttgaggttc |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
40139414 |
atggacgcaaaggacgggttagaccgaattgtatgtaacctgaactcgaccataacattagttcgagccaatttgtaactcgaacccaaccttgaggttc |
40139513 |
T |
|
| Q |
217 |
ggatctagtaaggacgggacaatcaagaca |
246 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |
|
|
| T |
40139514 |
ggatctaataaggacaggacaatcaagaca |
40139543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 248 - 289
Target Start/End: Original strand, 40139567 - 40139608
Alignment:
| Q |
248 |
attattcattaggggttaaatccatcacaccacttagaataa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40139567 |
attattcattaggggttaaatccatcacaccacttagaataa |
40139608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University