View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5943_high_4 (Length: 255)

Name: NF5943_high_4
Description: NF5943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5943_high_4
NF5943_high_4
[»] chr6 (1 HSPs)
chr6 (1-50)||(7212913-7212962)


Alignment Details
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 7212962 - 7212913
Alignment:
1 cgagagagatgagagttttacagtgtggcacgacaaaggaagagggaggt 50  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||    
7212962 cgagagagatgagagttttacagtgtggcgcgacaaaggaagagggaggt 7212913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University