View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5943_low_6 (Length: 253)
Name: NF5943_low_6
Description: NF5943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5943_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 3359757 - 3360003
Alignment:
| Q |
1 |
ctcaaattcaggtttcttcttttcccgagccttcaactttgaagggaaatgttcaaaggacttgctgaagttaacatcaaattctgattctgtatcagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359757 |
ctcaaattcaggtttcttcttttcccgagctttcaactttgaagggaaatgttcaaaggacttgctgaagttaacatcaaattctgattctgtatcagaa |
3359856 |
T |
 |
| Q |
101 |
aaacaaaaatttagaggataaacagtttgtaggggtaccaaatcttcatccggagcagcattgtattcttccccataggctcttcttgcagtttttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3359857 |
aaacaaaaatttagaggataaacagtttgtaggggtaccaaatcttcatccggagcagcattgtattcttccccgtaggctcttcttgcagtttttggaa |
3359956 |
T |
 |
| Q |
201 |
caaaatcatgcaggttattagctaaatcagaattttcactttcttct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359957 |
caaaatcatgcaggttattagctaaatcagaattttcactttcttct |
3360003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 157
Target Start/End: Original strand, 22067016 - 22067087
Alignment:
| Q |
85 |
tgattctgtatcagaaaaacaaaaatttagaggataaacagtttgtaggggtaccaaatcttcatccggagca |
157 |
Q |
| |
|
|||||||| ||||| |||||||| ||| ||||||||||| |||||| |||||| |||| ||||||||||||| |
|
|
| T |
22067016 |
tgattctgcatcagcaaaacaaattttttgaggataaacaatttgta-gggtactaaattttcatccggagca |
22067087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University