View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945-Insertion-12 (Length: 140)
Name: NF5945-Insertion-12
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945-Insertion-12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 1e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 9 - 132
Target Start/End: Complemental strand, 5967801 - 5967670
Alignment:
| Q |
9 |
cttattataatatttaattaaggcttatcgtaactttaacgacaatcacaat--------gttgtgtcttgtgctccacccatctcacttagaatagcag |
100 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5967801 |
cttattatagtatttaattaaggcatatcgtaactttaacgacaatcacaatctcaatatgttgtgtcttgtgctccacccatgtcacttagaatagcag |
5967702 |
T |
 |
| Q |
101 |
cttctgtttgtctaactcatcttctttcttgt |
132 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| |
|
|
| T |
5967701 |
cttctgtttgtctaattcagcttctttcttgt |
5967670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University