View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945-Insertion-7 (Length: 271)
Name: NF5945-Insertion-7
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945-Insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 2618877 - 2618740
Alignment:
| Q |
10 |
tttttgcaggaaccaccaagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2618877 |
tttttgcaggaaccacctagtaatttgtccccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaac |
2618778 |
T |
 |
| Q |
110 |
tctttttctcacaaccttcaatctgcaccacaggttct |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2618777 |
tctttttctcacaaccttcaatctgcaccacagtttct |
2618740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 39 - 147
Target Start/End: Complemental strand, 2630557 - 2630449
Alignment:
| Q |
39 |
cccattcttgcaaacaaagtcacacacttcacttagagttgggccaacacatgaactagcgaagaaagaactctttttctcacaaccttcaatctgcacc |
138 |
Q |
| |
|
||||| |||||||| ||||||||| || |||||| |||||||||| |||| || | ||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
2630557 |
cccatgcttgcaaataaagtcacaattttggcttagaattgggccaacgcatggaccaacgaagtcaggactctttttctcacaaccttcaatttgcacc |
2630458 |
T |
 |
| Q |
139 |
acaggttct |
147 |
Q |
| |
|
|||| |||| |
|
|
| T |
2630457 |
acagcttct |
2630449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 106 - 147
Target Start/End: Complemental strand, 2624215 - 2624174
Alignment:
| Q |
106 |
gaactctttttctcacaaccttcaatctgcaccacaggttct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2624215 |
gaactctttttctcacaaccttcaatcttcaccacagcttct |
2624174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University