View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945-Insertion-8 (Length: 252)
Name: NF5945-Insertion-8
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945-Insertion-8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 29295557 - 29295791
Alignment:
| Q |
8 |
agtattcatgaacatggtaactcatagtttagatatcacattgatttatatttcaattcgaggttttaaatttcagtcacggttatgattatgtcactat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295557 |
agtattcatgaacatggtaactcatagtttagatatcacattgatttatatttcaattcgaggttttaaatttcagtcacggttatgattatgtcacta- |
29295655 |
T |
 |
| Q |
108 |
ctttgatattacggaaaattattgttgatgtgcaattgtgattgcaaatatgtagcactgacacttcacatagaaggcgtttctaaatttaattatttca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295656 |
-----atattacggaaaattattgttgatgtgcaactgtgattgcaaatatgtagcactgacacttcacatagaaggcgtttctaaatttaattatttca |
29295750 |
T |
 |
| Q |
208 |
ttctttttccaagttattacaatgtgccagtatcaaatatt |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29295751 |
ttctttttccaagttattacaacgtgccagtatcaaatatt |
29295791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University