View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945_low_10 (Length: 269)
Name: NF5945_low_10
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 3 - 253
Target Start/End: Complemental strand, 50751675 - 50751425
Alignment:
| Q |
3 |
catcacagatcaatccagaggatgtgtcgagttggcttgcattggaagaaactgaagatgtcaacatggtgcaaacccaaagagattcatggaagaaatg |
102 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50751675 |
catcactgatcaatccagaggatgtgtcgagttggcttgcattggaagaaactgaagatgtcaacatggtgcaaacccaaagagattcatggaagaaatg |
50751576 |
T |
|
| Q |
103 |
tgatttctcagttggaaaatggatatttgatcaaacctaccctctctatgattccaactgtccttatctcaccactgcagttacttgtcaaaagaatgga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50751575 |
tgatttctcagttggaaaatggatatttgatcaaacctaccctctctatgattccaactgtccttatctcaccactgcagttacttgtcaaaagaatgga |
50751476 |
T |
|
| Q |
203 |
cggccagattcggattatgagaaatggaagtggaagccattaggttgttcc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50751475 |
cggccagattcggattatgagaaatggaagtggaagccattaggttgttcc |
50751425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 241
Target Start/End: Complemental strand, 19414875 - 19414734
Alignment:
| Q |
100 |
atgtgatttctcagttggaaaatggatatttgatcaaacctaccctctctatgattccaactgtccttatctcaccactgcagttacttgtcaaaagaat |
199 |
Q |
| |
|
|||||| || || |||||||||||| | | |||| || | |||||||| |||||| | ||||| |||||||| | ||||||||||||||||| |||||| |
|
|
| T |
19414875 |
atgtgacttttctgttggaaaatgggtttatgatgaatcttaccctctttatgatcctaactgcccttatcttagtactgcagttacttgtcagaagaat |
19414776 |
T |
|
| Q |
200 |
ggacggccagattcggattatgagaaatggaagtggaagcca |
241 |
Q |
| |
|
|| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
19414775 |
gggaggccagattccgattatgagaagtggaagtggaagcca |
19414734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University