View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945_low_13 (Length: 250)
Name: NF5945_low_13
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 45227908 - 45227786
Alignment:
| Q |
1 |
tttacatattcaaataacattgttcataaccaaatttccatataacaatgtaaatgacattcattgcttgagtatgtgtgaaatgcattaaaacataatt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45227908 |
tttacatattcaaataatattgttcataaccaaatttccatataacaatggaagtgacattcattgcttgagtctgtgtgaaatgcattaaaacataatt |
45227809 |
T |
|
| Q |
101 |
gatatatgaaataggggtcctta |
123 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45227808 |
aatatatgaaataggggtcctta |
45227786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 153 - 199
Target Start/End: Complemental strand, 45227743 - 45227697
Alignment:
| Q |
153 |
cattatgcgagaaaagaatattggtttattaattaactaacatgaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45227743 |
cattatgcgagaaaagaatattggtttattaattaactaacatgaag |
45227697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University