View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945_low_14 (Length: 243)
Name: NF5945_low_14
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945_low_14 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 45228150 - 45227925
Alignment:
| Q |
16 |
caaaatcaagatcacagggaagggacgctgatttggctaacaatctatgggatttcagcatgaatttgattaaggacaaatagaataaccaaagagaaat |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45228150 |
caaaattaagatcacagggaagggacgctgatttggctaacaatctatgggatttcagcatgaatttgattaaggacaaatagaataaccaaagagaaa- |
45228052 |
T |
|
| Q |
116 |
gttatgttggacaannnnnnnggtgtccaacaccgtatgtgtactatatagatactannnnnnnnnna---aattgtttgtctctctcatggtcacatta |
212 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| |||||||||||| | || ||||| ||||||| || ||||||||| |
|
|
| T |
45228051 |
----tgttggataacttttttggtgtccaacaccgtatgtgtaccatatagatactattttttttttaattaactgtttatctctcttatagtcacatta |
45227956 |
T |
|
| Q |
213 |
atagtaataaatgatgtatttgtatccggtt |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
45227955 |
atagtaataaatgatgtatttctatccggtt |
45227925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 45209344 - 45209255
Alignment:
| Q |
18 |
aaatcaagatcacagggaagggacgctgatttggctaacaatctatgggatttcagcatgaatttgattaaggacaaatagaataaccaa |
107 |
Q |
| |
|
|||||||| ||||| || | ||| |||||||||||||| || || ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45209344 |
aaatcaagttcacatgggaaggatgctgatttggctaagaaactttgggatttcagcatgaatttgatcaaggacaaatagaataaccaa |
45209255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 107
Target Start/End: Complemental strand, 45245499 - 45245418
Alignment:
| Q |
26 |
atcacagggaagggacgctgatttggctaacaatctatgggatttcagcatgaatttgattaaggacaaatagaataaccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
45245499 |
atcacagggaagggacgctgatttggctaagaaactttgggatttcagcatgaatttgattacgaaggaatagaataaccaa |
45245418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 36 - 107
Target Start/End: Complemental strand, 45202953 - 45202882
Alignment:
| Q |
36 |
agggacgctgatttggctaacaatctatgggatttcagcatgaatttgattaaggacaaatagaataaccaa |
107 |
Q |
| |
|
||||||||||||||||| || || || |||||||||||||| |||||| ||||| | ||||||||||||||| |
|
|
| T |
45202953 |
agggacgctgatttggcaaagaaactctgggatttcagcatcaatttggttaagcagaaatagaataaccaa |
45202882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University