View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945_low_15 (Length: 236)
Name: NF5945_low_15
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 2410789 - 2411015
Alignment:
| Q |
1 |
gacggcgtttatcaggtttggtgaggtcgacaaacttaggtgcttcgatcttctcgtagaaatcgtcgtcaatttctatttcctcttcttcaattatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410789 |
gacggcgtttatcaggtttggtgaggtcgacaaacttaggtgcttcgatcttctcgtagaaatcgtcgtcaatttctatttcctcttcttcaattatagg |
2410888 |
T |
 |
| Q |
101 |
caagaatcgattttctgacattattttgttaacaaaagaaaagtgttacagtaacacagtgttgtttttgttttggtgtttgtaacaacaagtttagatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2410889 |
caagaatcgattttctgacattattttgtt--------aagagcgttacagtaacacagtgttgtttttgttttggtg-ttgtaacaacaagtttagatt |
2410979 |
T |
 |
| Q |
201 |
gttcgaagaattttaaagtcccgtgtaactagccgt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410980 |
gttcgaagaattttaaagtcccgtgtaactagccgt |
2411015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University