View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5945_low_6 (Length: 403)

Name: NF5945_low_6
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5945_low_6
NF5945_low_6
[»] chr7 (1 HSPs)
chr7 (289-403)||(35443279-35443393)
[»] chr8 (1 HSPs)
chr8 (1-99)||(28754288-28754385)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 289 - 403
Target Start/End: Complemental strand, 35443393 - 35443279
Alignment:
289 ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg 388  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35443393 ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg 35443294  T
389 atacacttcactcat 403  Q
    |||||||||||||||    
35443293 atacacttcactcat 35443279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 28754385 - 28754288
Alignment:
1 ataaagagatttgctctttcgtatgggaaaataattaaggaaggtgtcacaaattcgaaaaatgatcaataagtgacttaccgtatatggatagttaac 99  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
28754385 ataaagagatttgctctttcgtacgggaaaataattaaggaaggtgtcacaaa-tcgaaaaatgatcaataagtgacttaccgtatatggatagttaac 28754288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University