View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5945_low_6 (Length: 403)
Name: NF5945_low_6
Description: NF5945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5945_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 289 - 403
Target Start/End: Complemental strand, 35443393 - 35443279
Alignment:
| Q |
289 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443393 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
35443294 |
T |
|
| Q |
389 |
atacacttcactcat |
403 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35443293 |
atacacttcactcat |
35443279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 28754385 - 28754288
Alignment:
| Q |
1 |
ataaagagatttgctctttcgtatgggaaaataattaaggaaggtgtcacaaattcgaaaaatgatcaataagtgacttaccgtatatggatagttaac |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28754385 |
ataaagagatttgctctttcgtacgggaaaataattaaggaaggtgtcacaaa-tcgaaaaatgatcaataagtgacttaccgtatatggatagttaac |
28754288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University