View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5949-Insertion-8 (Length: 210)
Name: NF5949-Insertion-8
Description: NF5949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5949-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 210
Target Start/End: Original strand, 3359574 - 3359775
Alignment:
| Q |
9 |
accatcaatttcatcctggcccggttgcatcgccctccaagtaattttactgttcgtcggcttgtttaagactgtatcagcagtccatgtttccggttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3359574 |
accatcaatttcatcctggcccggttgcatcgccctccaagtaattttactgttcgtcggctcgtttaagactgtataagcagtccatgtttccggttta |
3359673 |
T |
|
| Q |
109 |
cgctgcctcttggttgatatattcatagacgtacttggaataactgatctgggactgttaagtggttctctagcaagacatgcctcaaattcaggtttct |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3359674 |
cgctgcctcttggttgatacattcatagacgtacttggaataactgatgtgggactgttaagtggttctctagcaagacatgcctcaaattcaggtttct |
3359773 |
T |
|
| Q |
209 |
tc |
210 |
Q |
| |
|
|| |
|
|
| T |
3359774 |
tc |
3359775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University