View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5950_high_15 (Length: 236)
Name: NF5950_high_15
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5950_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 41999313 - 41999533
Alignment:
| Q |
5 |
cacaactctatacacctttgaatgatggcacactgaaatctgagaaatggtttaaatctatgagtattatgattttacttttcaaaattacaatttatta |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41999313 |
cacaactctatacacctttgattgatggcacactgaaatctgagaaatggtttaaatctatgagtattatgattttacttttcaaaattacaatttatta |
41999412 |
T |
 |
| Q |
105 |
tacgtgatgaattatacactaagacggtgcttcaagtttaatatnnnnnnntcactttgttttttgtaccatcactttgtttaannnnnnnnnagatgag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41999413 |
tacgtgatgaattatacactaagacggtgcttcaagtttaatataaaaaaatcactttgttttttgtaccatcactttgtttaatttttctttagatgag |
41999512 |
T |
 |
| Q |
205 |
atactcttgttatatatatat |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41999513 |
atactcttgttatatatatat |
41999533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University