View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5950_high_18 (Length: 201)

Name: NF5950_high_18
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5950_high_18
NF5950_high_18
[»] chr3 (2 HSPs)
chr3 (63-187)||(49446697-49446821)
chr3 (19-51)||(49446834-49446866)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 63 - 187
Target Start/End: Complemental strand, 49446821 - 49446697
Alignment:
63 agtgacaaatgttacctgttagttattagatttactattcattttttggaatgataaatatctaatctgcttttacttctgttcaaaatctgccatcaca 162  Q
    |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||    
49446821 agtgacaaatgttaccagttagttgttagatttactattcattttttggaatgataaatatctaatctgcttttacttctgtgcaaaatcttccatcaca 49446722  T
163 aattttctgtattagttgttatgtg 187  Q
    |||||||||||||||||||||||||    
49446721 aattttctgtattagttgttatgtg 49446697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 49446866 - 49446834
Alignment:
19 agacctctaacttagctcaaaccagttagatta 51  Q
    |||||||||||||||||||| ||||||||||||    
49446866 agacctctaacttagctcaatccagttagatta 49446834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University