View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5950_low_14 (Length: 248)
Name: NF5950_low_14
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5950_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 49447534 - 49447281
Alignment:
| Q |
13 |
attaatgataattattaaatgtttaacaaagagcttgacnnnnnnn--gtgtaataaagagaattctataaaaatcaatatttttactcttttactagtt |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49447534 |
attaataataattattaaatgtttaacaaagagcttgaccaaaaaaacgtgtaataaagagaattctataaaaatcaatattttcactcttttactagtt |
49447435 |
T |
 |
| Q |
111 |
ttttgacgcatagtcttttgctagttaacaaagaaaacagaaatttagaaata---ctccgt-tc------------atccgttgcactactgctagtac |
194 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||||||||||||||||||||||| ||| | || ||||||||||||||||||||||| |
|
|
| T |
49447434 |
ttttgacgcacactcttttgctatttaacaaagaaaacagaaatttagaaatatttttccatgtcattataaatgatatccgttgcactactgctagtac |
49447335 |
T |
 |
| Q |
195 |
ttgattcttaagaaaattaagaagagaacactagatagtagagatatctgacgc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49447334 |
ttgattcttaagaaaattaagaagagaacactagatagtagagatatctgacgc |
49447281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University