View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5950_low_17 (Length: 214)
Name: NF5950_low_17
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5950_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 40182135 - 40182327
Alignment:
| Q |
13 |
caaattttatcgccgaattagctctgctggagtaaagtatgctttgttatgctccatcacttatagcagcttcttcaattttcctggccaaatatatgct |
112 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182135 |
caaattttatcgccgaattatctctgttggagtacagtatgctttgttatgctccatcacttatagcagcttcttcaattttcctggccaaatatatgct |
40182234 |
T |
 |
| Q |
113 |
tttccctgcaatgaaaccatgggtatgctgctaatgacgaagattcatgtgtcccattataattagagaaatgaatcataaattttcctttgct |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40182235 |
tttccctgccatgaaaccatgggtatgctgctaatgacgaagattcatgtgtcccactataattagag-aatgaatcataaattttcctttgct |
40182327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University