View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5950_low_18 (Length: 201)
Name: NF5950_low_18
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5950_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 63 - 187
Target Start/End: Complemental strand, 49446821 - 49446697
Alignment:
| Q |
63 |
agtgacaaatgttacctgttagttattagatttactattcattttttggaatgataaatatctaatctgcttttacttctgttcaaaatctgccatcaca |
162 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
49446821 |
agtgacaaatgttaccagttagttgttagatttactattcattttttggaatgataaatatctaatctgcttttacttctgtgcaaaatcttccatcaca |
49446722 |
T |
 |
| Q |
163 |
aattttctgtattagttgttatgtg |
187 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49446721 |
aattttctgtattagttgttatgtg |
49446697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 49446866 - 49446834
Alignment:
| Q |
19 |
agacctctaacttagctcaaaccagttagatta |
51 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
49446866 |
agacctctaacttagctcaatccagttagatta |
49446834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University