View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5950_low_4 (Length: 362)
Name: NF5950_low_4
Description: NF5950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5950_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 28 - 187
Target Start/End: Complemental strand, 41999255 - 41999094
Alignment:
| Q |
28 |
gtggcggagact-ttcgtggtcacgtctcacctcaaaaaa-ttaaaagaattattaacagtaggtttattttgtaaggatttaaataattttaccaaggt |
125 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||| ||||||| |||||| || ||||||||||||||||||| ||||||||||||||| | ||| |
|
|
| T |
41999255 |
gtggcggaaactattcgtggtcacgtctcatctcaaaaaaattaaaaggattatttaccgtaggtttattttgtaaggttttaaataattttacgacggt |
41999156 |
T |
 |
| Q |
126 |
tttagtttccgcatatccaaattttcaaaaagtggtgcagtggcccatttaaaatattttaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
41999155 |
tttagtttccgcatatccaaattttcaaaaagtggtgcagtggttcactcaaaatattttaa |
41999094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 258 - 347
Target Start/End: Complemental strand, 41999023 - 41998934
Alignment:
| Q |
258 |
gttctaaatatgacatgcatgatttcttttcatgcttgtacttagctcgttagtggaggtttccaaatcttctaatttacggggttttct |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41999023 |
gttctaaatatgacatgcatgatttcttttcatgcttgtacttagctcgttagtggaggtttccaaatcttctaatttacggggttttct |
41998934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University