View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5951_high_12 (Length: 373)
Name: NF5951_high_12
Description: NF5951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5951_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 224 - 357
Target Start/End: Original strand, 5752456 - 5752589
Alignment:
| Q |
224 |
aaataattgaatgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcatcccaggtatgtatgctagtcttgcatattttga |
323 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5752456 |
aaataattgaacgccaaaccgcatggaggagagttgtttcccttgctgtcaattcaggtatcagcctcccgggtatgtctgctagtcttgcatattttga |
5752555 |
T |
 |
| Q |
324 |
cacttatagaagggaaaggttgccacctaatttg |
357 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||| |
|
|
| T |
5752556 |
ctcttatagaagggaaaggttgccagctaatttg |
5752589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 4 - 148
Target Start/End: Original strand, 5752211 - 5752355
Alignment:
| Q |
4 |
gaagcagttgattgatgatgttaggaaggctctttacgcagccaagatctgtggttacgcataagggatgaatctgatcagtgcaaagagcactgaaaag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
5752211 |
gaagcagttgattgatgatgttaggaaggctctttatgcagccaagatttgtagttacgcacaagggatgaatctgatccgtgcaaagagtgctgaaaag |
5752310 |
T |
 |
| Q |
104 |
ggatgggatttggcattgggtgaacttgcccgtatttggaaagga |
148 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5752311 |
ggttgggatttggaattgggtgaacttgcccgtatttggaaagga |
5752355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 5752399 - 5752452
Alignment:
| Q |
156 |
cgtacgacagaa-ccctaatcttacaaaccttcttgtggatccaaagttcgcaa |
208 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
5752399 |
cgtacgacagaaaccctaatctcgctaaccttcttgtggatccagagttcgcaa |
5752452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University