View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5951_high_17 (Length: 326)
Name: NF5951_high_17
Description: NF5951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5951_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 20 - 318
Target Start/End: Original strand, 3568294 - 3568592
Alignment:
| Q |
20 |
gttccttccaaggatatttccgccaactcctttagcttcaccttgaagaatgtgtcggatcatattcctcaaggtagacttcctcgtcctgatatccatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568294 |
gttccttccaaggatatttccgccaactcctttagcttcaccttgaagaatgtgtcggatcatattcctcaaggtagacttcctcgtcctgatatccatg |
3568393 |
T |
 |
| Q |
120 |
ttttggagttggccactgatgttgagcaagatgacatgcaagttcttcaaatggagcaaacgcagccagaaaacacgaacttgcatgttcctttttcggt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3568394 |
ttttggagttggccactgatgttgagcaagatgacatgcaagttcttcaaatggagcaaacgcagccagaaaacacgaactcgcatgttcctttttcggt |
3568493 |
T |
 |
| Q |
220 |
tgcagctgcgtcggtttcaagttttgtagagcacgttgaagtgcatgatgatttggcttctactgatttggtttctgctagagagcaatctcctttgct |
318 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3568494 |
tgcagctgcgtccgtttcaagttttgtagagcacgttgaagtgcatgatgatttggcttctactgatttggtttctgctagagaggaatctcctttgct |
3568592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University