View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5951_low_34 (Length: 233)
Name: NF5951_low_34
Description: NF5951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5951_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 3346005 - 3345798
Alignment:
| Q |
12 |
aagaatatacttgatttctcaaacaaatggaaaaagtaataatcaataaataaaaccaattgtgttctctagtcatttcacttaattgtgaaaccaattc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3346005 |
aagaaaatacttgatttctcaaacaaatggaaaaagtaataatcaataaataaaaccaattgtgttctctagtcatttcacttaattgtgaaaccaattc |
3345906 |
T |
 |
| Q |
112 |
agtcc---nnnnnnnnnnngagagagaaatcaattcagtcctatagctagtaaatctcaacttgtgttttgcaagttgctcctcttgacatgactaaaaa |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3345905 |
agtccttttttttttttttgagagagaaatcaattcagtcctatagctagtaaatctcaacttgtgttttgcaagttgctcctcttgacatgactaaaaa |
3345806 |
T |
 |
| Q |
209 |
ttgatact |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
3345805 |
ttgatact |
3345798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University