View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5951_low_35 (Length: 231)
Name: NF5951_low_35
Description: NF5951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5951_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 47266317 - 47266104
Alignment:
| Q |
16 |
atatgttttccatacacactaacaaggaattgaatccccgactaaattattaaggcacccaaacctataatacttgtgtcacactagattggtattagaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47266317 |
atatgttttccatacacactaacaaggaattgaatccccgactaaattattaaggcacccaaacctataatacttgtgtcacactagatcggtattagaa |
47266218 |
T |
 |
| Q |
116 |
gttagaaccatatatagctttacctcgtctctgttgtatgtattatcggtaataaagcataattcttcaacatggggtgggttagtatcttcatacttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47266217 |
gttagaaccatatatagctttacctcatctctgttgtatgtattatcggtaataaagcataattcttcaacatggggtgggttaatatcttcatacttcc |
47266118 |
T |
 |
| Q |
216 |
ttttatgataaaaa |
229 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
47266117 |
ttttatgatcaaaa |
47266104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University