View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5952_high_7 (Length: 246)
Name: NF5952_high_7
Description: NF5952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5952_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 13307178 - 13307388
Alignment:
| Q |
18 |
gaaacatattaaattcaaggaacagtaatgaaatattgtaatcagtgcagaccgatgttaaactctagaaattatccaaaaaggatgtaaagttcaagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13307178 |
gaaacatattaaattcaaggaacagtaatgaaatattgtaatcagtgcagaccgatgttaaactctagaaattatccaaaaaggatgtaaagttcaagta |
13307277 |
T |
|
| Q |
118 |
ttcagatgaacttcaataacgtgcaaaattatctgatttttcattcaaatagatccaaaacacagtcttcatgcaccatagcttaacatattaatctctc |
217 |
Q |
| |
|
||||||||||||||| |||| |||||||||||| |||||||||||||||| | ||||||||||||||||||||||||| ||||||||| |||| || ||| |
|
|
| T |
13307278 |
ttcagatgaacttcattaacatgcaaaattatccgatttttcattcaaat-ggtccaaaacacagtcttcatgcaccacagcttaacaaattattccctc |
13307376 |
T |
|
| Q |
218 |
catctatgctct |
229 |
Q |
| |
|
||| |||||||| |
|
|
| T |
13307377 |
catatatgctct |
13307388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University