View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5952_low_6 (Length: 270)
Name: NF5952_low_6
Description: NF5952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5952_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 30782858 - 30783112
Alignment:
| Q |
1 |
gacgaattgtttagagtttagaccataactaatccctagacctgaacaaactcaatgctttgcgctgcgggtcaaattaagaccaagtctatttaagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782858 |
gacgaattgtttagagtttagactataactaatccctagacctgaacaaactcaatgctttgcgctgcgggtcaaattaagaccaagtctatttaagcaa |
30782957 |
T |
 |
| Q |
101 |
atgacaattgaagaaaaattataaggtgatcattcaattatgactaaaaattacaagtaaaaaattga-tttattttaatattttaccatgtactcaaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30782958 |
atgacaattgaagaaaaattataaggtgatcattcaattatgactaaaaattacaagtaaaaaattgattttattttaatattttaccatgtactcaaac |
30783057 |
T |
 |
| Q |
200 |
tcaaaatatgactcttacaatagtactttactacaagtatgctgtctaaactaac |
254 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30783058 |
tcaaaatatgactcttacaatagcactttactacaagtatgctgtctaaactaac |
30783112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 11067755 - 11067817
Alignment:
| Q |
173 |
ttttaatattttaccatgtactcaaactcaaaatatgactcttacaatagtactttactacaa |
235 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| || ||||||||| |||| ||||||| |
|
|
| T |
11067755 |
ttttagtattttaccatgtattcaaactcaaaatacttcttttacaatagcacttcactacaa |
11067817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University