View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_13 (Length: 339)
Name: NF5953_low_13
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 110 - 329
Target Start/End: Complemental strand, 25006050 - 25005835
Alignment:
| Q |
110 |
atttaatctgtgtgtttttgtacatggaccagttcaacaaatatttggaggctccttttcatgatgtttatatatagttcacttttagttgtttatcatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25006050 |
atttaatctgtgtgtttttgtacatggaccagttcaacaaatatttggaggctcctttacatgatgtttata----gttcacttttagttgtttatcatt |
25005955 |
T |
|
| Q |
210 |
attattttgatcatggtgcagaggaacaaagactcagttttggaatagaaaactctagcacttgatatagatgatgagcttgagatataaacatttgatt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25005954 |
attattttgatcatggtgcagaggaacaaagactcagttttggaatagaaaactctaccacttgatatagatgatgagcttgagatataaacatttgatt |
25005855 |
T |
|
| Q |
310 |
catcagacacttattttcat |
329 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25005854 |
catcagacacttattttcat |
25005835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 25006457 - 25006366
Alignment:
| Q |
18 |
attttaactagctttatttgtcatagagtattaagatagactttgaatcatctcgacaatttggaggctttcagtgttgttctgcggcgaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
25006457 |
attttaactagctttatttgtcatagagtattaagatagactttgaatcatctcgacaatttggaggctttcggtgttgttctgcagcgaat |
25006366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University