View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_22 (Length: 254)
Name: NF5953_low_22
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 25 - 226
Target Start/End: Complemental strand, 41836639 - 41836429
Alignment:
| Q |
25 |
tcacatagtatctcacgcgtgggatcccacctctaatactactcattattatta---ctctcattcnnnnnnnnnnnn--cccnnnnnnnntctaactca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
41836639 |
tcacatagtatctcacgcgtgggatcccacctctaatactactcattattattattactctcattcatttttttttctttcccaaaaaaaatctaactca |
41836540 |
T |
 |
| Q |
120 |
aac----attgtgtatttgaaactcctcataaaattatattttagacaatttatgattnnnnnnntaataattttagataatttaattgaattgttttta |
215 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41836539 |
aacttggatcgtgtatttgaaactcctcataaaattatattttagacaatttatgattaaaaaaataataattttagataatttaattgaattgttttta |
41836440 |
T |
 |
| Q |
216 |
cttctaaaatg |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
41836439 |
cttctaaaatg |
41836429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University