View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_23 (Length: 253)
Name: NF5953_low_23
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 14855010 - 14855228
Alignment:
| Q |
19 |
atatttcaacttttaacggctctgttgcgattaacactggcattgttcaggcgataattactcagacagtgtttgatcagaatcctattgcgatttttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14855010 |
atatttcaacttttaacggctctgttgcgattaacactggcattgttcaggcgataattactcagacagtgtttgatcagaatcctattgcgatttttgg |
14855109 |
T |
 |
| Q |
119 |
tgtttcgaaggttttgttgcctagagagatttttgggaagaatccaattgtctctgcgaaatcaccaccggagactagtgctcctcctccttatgaggat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14855110 |
tgtttcgaaggttttgttgcctagagagatttttgggaagaatccaattgtctctgcgaaatcaccaccggagagtagtgctcctcctccttatgaggat |
14855209 |
T |
 |
| Q |
219 |
gcttcttcgcccacaggtt |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14855210 |
gcttcttcgcccacaggtt |
14855228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University