View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5953_low_23 (Length: 253)

Name: NF5953_low_23
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5953_low_23
NF5953_low_23
[»] chr2 (1 HSPs)
chr2 (19-237)||(14855010-14855228)


Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 14855010 - 14855228
Alignment:
19 atatttcaacttttaacggctctgttgcgattaacactggcattgttcaggcgataattactcagacagtgtttgatcagaatcctattgcgatttttgg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14855010 atatttcaacttttaacggctctgttgcgattaacactggcattgttcaggcgataattactcagacagtgtttgatcagaatcctattgcgatttttgg 14855109  T
119 tgtttcgaaggttttgttgcctagagagatttttgggaagaatccaattgtctctgcgaaatcaccaccggagactagtgctcctcctccttatgaggat 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
14855110 tgtttcgaaggttttgttgcctagagagatttttgggaagaatccaattgtctctgcgaaatcaccaccggagagtagtgctcctcctccttatgaggat 14855209  T
219 gcttcttcgcccacaggtt 237  Q
    |||||||||||||||||||    
14855210 gcttcttcgcccacaggtt 14855228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University